CROSS-REFERENCE TO RELATED APPLICATIONS
This application is a National Stage application of PCT/JP2016/063326, filed Apr. 28. 2016, which claims priority from Japanese application JP2015-093599, filed Apr. 30, 2015.
Technical Field
The present invention relates to a method of predicting an effect of treatment by a PD-1/PD-L1 blockade such as anti PD-1 antibody by examining the presence or absence of an abnormality of PD-L1 gene in a tumor cell.
Sequence Listing
The present application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy, created on Apr. 26, 2016, is named PH-6552-PCT_SL.txt and is 10,000 bytes in size.
Background Art
Recently, it has been elucidated that a PD-1/PD-L1 blockade is effective for various types of malignant tumors including metastatic malignant melanoma, renal cancer, lung cancer and Hodgkin's disease. As the PD-1/PD-L1 blockade, an anti PD-1 monoclonal antibody, i.e., Nivolumab, has been put into practical use (see, Patent Literature 1). At present, searching a biomarker for predicting an effect of treatment by this blockade is an urgent issue. It has been found that the efficacy rate is high when “PD-L1 positive” is found by immunostaining in tumor cells and peripheral immune cells. However, evaluation of PD-L1 positive rate by immunostaining is not sufficient in view of sensitivity/specificity. It is desired that prediction on efficacy of therapy is further improved.
It has been increasingly clear that a PD-1/PD-L1 blockade is effective in many malignant tumors. Of them, malignant tumors on which the blockade less effectively works are included. However, even in such tumors, a case having a structural abnormality of PD-L1 accompanied by high expression thereof is likely to be present. However, a useful method for sorting out a case where a PD-1/PD-L1 blockade possibly works has not yet been established.
CITATION LIST Patent Literature
Patent Literature 1: JP Patent Publication (Kokai) No. 2006-340714
SUMMARY OF INVENTION Technical Problem
An object of the present invention is to provide an effective method for predicting an effect of treatment by a PD-1/PD-L1 blockade. Another object is to develop a platform for sorting out a case on which these blockades effectively work with a high probability even in tumors to which a PD-1/PD-L1 blockade has not yet been applied, and then applying a treatment to the case.
Solution to Problem
The present inventors conducted comprehensive gene analysis (RNA sequencing: 57 cases, whole genome sequencing: 11 cases) of adult T cell leukemia/lymphoma (ATL). Based on the gene analysis, they clarified that a structural abnormality of PD-L1 (CD274) is present in about 20% of ATL cases. Examples of the structural abnormality include all structural abnormalities such as deletion, tandem duplication, inversion and translocation. These structural abnormalities commonly have a deletion of 3′UTR. Furthermore in all cases having a structural abnormality, a remarkable increase of PD-L1 mRNA level was observed and an increase of PD-L1 protein expression on the cell surface was confirmed by flow cytometry. Moreover, studies were conducted on the presence of the same abnormality in other cancers based on TCGA data. As a result, it was found that the same abnormality is present in various types of malignant tumors such as stomach cancer, lung cancer, large intestinal cancer, cervical cancer, malignant melanoma and B cell lymphoma. This result suggests that a structural abnormality, i.e., a deletion of 3′UTR of PD-L1 accompanied by high expression of PD-L1 is a common abnormality occurring in various types of malignant tumors.
Based on these results, the present inventors found that the effect of a PD-1/PD-L1 blockade can be determined and evaluated based on a deletion of 3′UTR in PD-L1 gene as an index and accomplished the present invention.
More specifically, the present invention is as follows.
[1] A method of predicting whether or not PD-1/PD-L1 blockade is effective for treatment of a subject suffering from malignant tumor, which comprises detecting abnormality of genome relating to effectiveness of the PD-1/PD-L1 blockade in a tumor cell taken from the subject and evaluating the PD-1/PD-L1 blockade as useful for the treatment of the subject when there is the abnormality.
[2] The method according to [1], wherein the abnormality of genome relating to effectiveness of the PD-1/PD-L1 blockade is abnormality of PD-L1 gene relating to the acceleration of the expression of PD-L1 (CD274) gene.
[3] The method according to [2], wherein the abnormality of PD-L1 gene is partial or complete deletion of 3′UTR region of PD-L1 gene.
[4] The method according to [2], wherein the abnormality of PD-L1 gene is change in copy number which induces deletion of 3′UTR region of PD-L1 gene.
[5] The method according to [2], wherein the abnormality of PD-L1 gene is complete or partial truncation of exon 5, exon 6 and exon 7 from PD-L1 transcript.
[6] The method according to [2], wherein the abnormality of PD-L1 gene is complete or partial truncation of exon 5, exon 6 and exon 7 from PD-L1 transcript.
[7] The method according to [2], which comprises quantifying a transcript of any one of exon 1 to exon 4 of PD-L1 gene and a transcript of 3′UTR region of PD-L1 gene and calculating a ratio between the amount of the transcript of the exon and the amount of the transcript of the 3′UTR region, and evaluating the PD-1/PD-L1 blockade as useful for the treatment of cancer when the ratio is not less than a predetermined value.
[8] The method according to [2], wherein the abnormality of PD-L1 gene is acceleration of the expression of PD-L1 mRNA.
[9] The method according to [2], wherein the abnormality of PD-L1 gene is the abnormality caused by the insertion of a virus.
[10] The method according to [9], wherein the virus is Human papilloma virus (HPV) or EBV (Epstein-barr virus).
[11] The method according to [2], which comprises staining a PD-L1 protein in a tumor cell taken from the subject by immunohistochemical staining using an antibody against a C terminal region of PD-L1 and an antibody against a N terminal region of PD-L1, and evaluating the PD-1/PD-L1 blockade as useful for the treatment of the subject when the tumor cell becomes stained with the antibody against a N terminal region of PD-L1 but the tumor cell does not become stained with the antibody against a C terminal region of PD-L1.
[12] The method according to any one of [1] to [11], wherein the malignant tumor is selected from the group consisting of adult T-cell leukemia/adult T-cell leukemia lymphoma, stomach cancer, large intestinal cancer, bladder cancer, cervical cancer, renal cancer, lung adenocarcinoma, cutaneous malignant melanoma, and B cell lymphoma.
[13] The method according to any one of [1] to [11], wherein the malignant tumor is selected from the group consisting of esophageal cancer, head and neck cancer, and uterine body cancer.
[14] The method according to any one of [1] to [13], wherein the PD-1/PD-L1 blockade is anti PD-1 antibody or anti PD-L1 antibody.
[15] A treatment method comprising detecting an abnormality of genome relating to effectiveness of a PD-1/PD-L1 blockade in a tumor cell taken from a subject suffering from a malignant tumor and applying a treatment with the PD-1/PD-L1 blockade when the abnormality is present.
Advantageous Effects of Invention
As shown in Examples, in various malignant tumors, there are cases where PD-L1 is highly expressed due to a structural abnormality of PD-L1 gene. More specifically, a structural abnormality of PD-L1 (mainly serving as an immune checkpoint) and the resulting fusion gene with a non-coding region were identified as a gene abnormality in various types of malignant tumors beyond ordinal expectation. In consideration that an anti PD-1/PD-L1 blockade is overwhelmingly effective (efficacy rate: about 90%) in a preclinical study (mouse model) of this research and in Hodgkin's disease, which is known as only one case where PD-L1 is constantly activated by a genomic abnormality, it is expected that an anti PD-1/PD-L1 blockade is extremely effective for patients having a PD-L1 structural abnormality and becomes a prospective biomarker. Accordingly, the genetic abnormality directly relating to an effective treatment is an extremely prospective target for clinical examination.
As to a malignant tumor to which a PD-1/PD-L1 blockade is already applied, an effect of treatment by the PD-1/PD-L1 blockade can be successfully predicted based on detection of a PD-L1 structural abnormality. Also, even in the cases of tumors to which a PD-1/PD-L1 blockade has not yet been applied, if an abnormality of PD-L1 gene is present therein, the PD-1/PD-L1 blockade is likely to be effective. If such a case is sorted out, a novel therapy can be possibly established. In addition, if a clinical trial is carried out based on a structural abnormality of PD-L1 as an index, the number of diseases for which it is indicated can be effectively increased. This means that the range of the indication is not limited to malignant tumors, for which the indication has been approved or under consideration, and can be enlarged to malignant tumors, for which effectiveness of the blockage is in general regarded as being insufficient.
(
DESCRIPTION OF EMBODIMENTS
Now, the present invention will be more specifically described, below.
The present invention relates to a method of evaluating and determining the effectiveness of a PD-1/PD-L1 blockade in a patient with a malignant tumor, based on a genomic abnormality relating to effectiveness of the PD-1/PD-L1 blockade in the patient as an index, or a method of obtaining supportive data for evaluating and determining the effectiveness of a PD-1/PD-L1 blockade in the patient. In the present invention, evaluation/determination is also referred to as prediction. PD-L1 is also referred to as CD274 or B7-H1.
The genomic abnormality relating to effectiveness of a PD-1/PD-L1 blockade herein refers to an abnormality, which is found in the genome of a patient with a malignant tumor and on which a PD-1/PD-L1 blockade has a high effect. Examples of such an abnormality include an abnormality of chromosome 9p24.1, on which PD-L1 gene is present, and an abnormality of PD-L1 gene. Such an abnormality is referred to also as a structural variation (SV) of PD-L1 gene. With these abnormalities, abnormal expression of PD-L1 can be induced in tumor cells of a patient with a malignant tumor. Examples of the genomic abnormality relating to effectiveness of a PD-1/PD-L1 blockade include structural abnormalities such as tandem duplication, deletion, inversion and translocation of a gene; abnormalities in number of copies such as an increase or decrease in number and uniparental disomy; and qualitative (deletion of 3′UTR) and quantitative abnormalities of an expression product and a transcript product. The PD-L1 abnormal expression in tumor cells refers to acceleration of PD-L1 gene expression compared to that in cells of a healthy person or that in tumor cells having a normal PD-L1 gene; more specifically, to the case where the expression of PD-L1 at an mRNA or protein level is 5 times or more, preferably 10 times or more, further preferably 20 times or more, and further preferably 50 times or more as high as normal cases. If abnormal expression of PD-L1 is detected, it is possible to predict that genomic abnormality relating to effectiveness of a PD-1/PD-L1 blockade is present.
In a living body, T cells have an immune function against a tumor (i.e., T cells attack tumor cells). However, when PD-L1 ligand expressed by a tumor cell binds to PD-1 (Programmed cell death 1) expressed by a T cell, cell death of the T cell is induced, with the result that the immune function against a tumor is suppressed. A PD-1/PD-L1 blockade blocks binding of PD-L1 of a tumor cell and PD-1 of a T cell, thereby suppressing the immune function of the T cell against a tumor. Examples of the PD-1/PD-L1 blockade include anti PD-1 antibody and anti PD-L1 antibody. Examples of the anti PD-1/PD-L1 antibody used as a cancer drug include Nivolumab, MPDL3280A, pembrolizumab (MK-3475), MEDI4736, MSB0010718C, Pidilizumab and MEDI0680. A PD-1/PD-L1 blockade highly effectively works in the case of a patient where PD-L1 is highly expressed in tumor cells and peripheral immune cells. Accordingly, if the expression level of PD-L1 is measured, the effectiveness of a PD-1/PD-L1 blockade can be determined. For example, expression of PD-L1 in a tumor cell can be checked by immunostaining; however, evaluation of a PD-L1 positive rate by immunostaining is not sufficient in view of sensitivity and specificity.
Whether genomic abnormality in a patient with a malignant tumor relates to the effectiveness of a PD-1/PD-L1 blockade in tumor cells can be found just by investigating whether genomic abnormality relates to acceleration of PD-L1 gene expression; more specifically, can be determined by comprehensively analyzing structural abnormalities of the whole genome in the tumor cell, at the same time, determining PD-L1 gene expression in the tumor cell at an mRNA level or protein level and associating a genomic (structural) abnormality with acceleration of the PD-L1 gene expression. Further more specifically, DNA is isolated from a tumor cell and the whole genome is sequenced and analyzed for genomic structural abnormalities such as tandem duplication, inversion, translocation and deletion; at the same time, the total RNA of the tumor cell is sequenced and PD-L1 gene expression is determined; and then, association of a genomic abnormality with the PD-L1 gene expression may be analyzed. For example, in a number of tumor cells having a certain genomic abnormality, if acceleration of PD-L1 gene expression is found, it can be determined that the abnormality is associated with acceleration of the PD-L1 gene expression and relates to the effectiveness of a PD-1/PD-L1 blockade.
Actually, when PD-L1 gene expression is accelerated by a genomic abnormality, apoptosis of T cells expressing PD-1 is induced. Also when PD-L1 gene expression is accelerated by a genomic abnormality, infiltration of CD8 positive cytotoxic T cells into a tumor is suppressed and tumor growth is accelerated. Furthermore, immunity escape due to PD-L1 genomic abnormality is suppressed by anti PD-1/PD-L1 block.
The type of tumor, to which the method of the present invention of evaluating and determining the effectiveness of a PD-L1/PD-1 blockade can be applied, is not limited. At least, adult T cell leukemia/lymphoma, stomach cancer, large intestine cancer, bladder cancer, cervical cancer, renal cancer, lung adenocarcinoma, skin malignant melanoma, B cell lymphoma, esophageal cancer, head and neck cancer and uterine body cancer, are mentioned. The large intestinal cancer includes colon cancer and rectal cancer.
In the method of the present invention, a tumor specimen is taken from a subject suffering from a malignant tumor and tumor cells of the specimen may be subjected to genomic abnormality analysis.
In the method of the present invention, as specific example of the analysis object, i.e., genomic abnormality relating to effectiveness of a PD-1/PD-L1 blockade, the following abnormalities are mentioned.
(1) Genomic Abnormality Having a 3′UTR (3′ Untranslated Region) Deletion of PD-L1 Gene
PD-L1 gene is present in 9p24.1 region. Examples of the structural abnormality of the gene include tandem duplication, inversion, translocation and deletion. When 3′UTR has a deletion due to structural abnormality of PD-L1 gene, PD-L1 is highly expressed. This is because 3′UTR is a region that plays an important role in keeping stability and regulating translation of mRNA, and if this region is deleted, the gene loses these functions. The deletion of 3′UTR in PD-L1 gene includes a complete deletion and a partial deletion. Examples of the abnormality in number of copies (CNV) of 9p24.1 region including PD-L1 gene include an increase and decrease in copy number and uniparental disomy. The abnormality in number of copies occurs in association with structural abnormality. When a deletion in the 3′UTR occurs, PD-L1 is highly expressed.
The PD-L1 gene having 3′UTR deleted is partly truncated in the middle of an exon region, with the result that a different protein from a wild-type PD-L1 is produced. PD-L1 (protein) consists of three domains, i.e., an extracellular domain, a transmembrane domain and a cytoplasmic domain. In binding to PD-1, the extracellular domain and transmembrane domain are participated. Even if the PD-L1 gene is truncated in the middle of the exon region, PD-L1 keeps a binding ability to PD-1. More specifically, even if PD-L1 gene is truncated in the middle of the exon region, as long as it has the extracellular domain and transmembrane domain, PD-L1 has a function suppressing antitumor immunity. Accordingly, regardless of whether the PD-L1 protein is truncated or not, a tumor cell highly expressing PD-L1 protein due to genomic abnormality of PD-L1 gene is blocked in the function of suppressing tumor immunity by a PD-1/PD-L1 blockade. Accordingly, blocking of the PD-1/PD-L1 is effective for treating a malignant tumor having a genomic abnormality of PD-L1 gene.
The nucleotide sequence of PD-L1 gene is registered under NM_014143. The nucleotide sequence of 3′UTR of PD-L1 gene is represented by SEQ ID No: 2.
(2) Abnormality in Transcript and Translated Product of PD-L1 Gene
As abnormality of PD-L1 mRNA, whole or partial truncation of 3′UTR of mRNA and accompanying high expression are mentioned. In addition, a truncation on or downstream of exon 5 or 6 may sometimes be present. As the truncation of exon, a truncation of a whole region of exon 6 and exon 7, a truncation of the whole exon 7 and a truncation in the middle of exon 7. In the present invention, such a truncation of exon refers to a truncation of exon 6 or a whole or partial truncation of exon 7. Further, a truncation on and downstream of exon 4, more specifically, a truncation of the whole region of exon 5, exon 6 and exon 7 may occur.
As abnormality of PD-L1 protein, high expression is mentioned. The high expression of PD-L1 protein occurs independent of an increase of PD-L1 gene in number of copies and relates to structural abnormality of PD-L1 gene. Since exon 5 or 6 constitutes the cytoplasmic domain of PD-L1 protein, if a deletion on and downstream exon 4 is present, the abnormality of PD-L1 protein includes a partial deletion of the cytoplasmic domain.
A carcinogenic virus such as HPV (e.g., Human papilloma virus (HPV) 16) and EBV (Epstein-barr virus), if it is introduced into PD-L1 gene region, sometimes induces a structural abnormality. For example, in some cases where Human papilloma virus (HPV) in inserted into intron 6 of PD-L1 gene and Epstein-Barr virus (EBV) gene is inserted in an upstream gene region adjacent to PD-L1 gene and located upstream thereof, a PD-L1 transcript is truncated at 3′UTR.
Genomic abnormality relating to effectiveness of a PD-1/PD-L1 blockade can be analyzed in accordance with a general method for analyzing genomic structural abnormality and gene abnormality using tumor cells taken from a patient with a malignant tumor. Examples of the analysis method include an analysis method based on sequence analysis by extracting DNA or RNA from tumor cells and directly determining the sequence thereof by a method known in the art such as the PCR/Sanger sequence method, dideoxy method and Maxam-Gilbert method; an analysis method for global gene including a whole genome sequencing, whole exon sequencing and a target sequencing by a next generation sequencer; a FISH (fluorescence in situ hybridization) method; a hybridization method using a specific probe to a region having a gene abnormality or a microarray (DNA chip) having a specific probe immobilized therein, such as a copy number analysis method using e.g., an SNP array and a CGH array; and methods using a specific primer to a region having a gene abnormality. Examples of the method using a primer include PCR method, NASBA method, LCR method, SDA method, LAMP method, a method using restriction fragment length polymorphism (RFLP) and a primer extension method (TaqMan (registered trade mark) method). As the next generation sequencer, e.g., Genome Sequencer FLX (GD FLX) (Roche) and Illumina HiSeq/MiSeq (Illumina) can be used.
A deletion in 3′UTR of PD-L1 gene can be detected by a method using a probe and/or a primer as well as by RNA sequencing and a FISH method.
A deletion of 3′UTR in mRNA can be detected by calculating the ratio of transcript amount of exons (exon 1 to 5) of PD-L1 gene having no deletion and the transcript amount of 3′UTR. More specifically, mRNA of any one of exons 1 to 5 of PD-L1 gene, for example, exon 3 or exon 4 and mRNA of 3′UTR region are quantified by RNA sequencing and quantitative PCR and the ratio of expression of exon 3 or exon 4/3′UTR expression is calculated. In this manner, the presence or absence of 3′UTR expression, more specifically, the presence or absence of 3′UTR deletion, can be determined. If the ratio is high, it can be determined that 3′UTR is deleted. The case where the ratio of exon 3 expression/3′UTR expression is large refers to the case where exon 3 expression/3′UTR expression is large relative to exon 3 expression/3′UTR expression in a tumor cell having no abnormality of PD-L1 gene; for example, refers to the case where the ratio of the exon 3 expression/3′UTR expression is a predetermined value or more, more specifically, double or more, preferably 3 times or more, further preferably 5 times or more. Similarly, the case where the ratio of exon 4 expression/3′UTR expression is large refers to the case where exon 4 expression/3′UTR expression is larger relative to exon 4 expression/3′UTR expression in a tumor cell having no abnormality of PD-L1 gene, for example, refers to the case where the ratio of exon 4 expression/3′UTR expression is a predetermined value or more, more specifically, double or more, preferably 3 times or more, further preferably 5 times or more.
The abnormal PD-L1 gene expression can be detected by measuring PD-L1 mRNA in a tumor cell by use of a (semi) quantitative PCR, such as RQ-PCR and RT-PCR. RQ-PCR is a method of continuously detecting accumulation of a PCR product during a PCR process, thereby enabling easy and accurate quantification in the exponential phase in the beginning of PCR.
The probe or primer to be used in the above methods, consists of a nucleotide fragment (preferably a DNA fragment) consisting of a nucleotide sequence containing a genomic abnormality site relating to acceleration of PD-L1 gene expression; a nucleotide sequence complementary to the nucleotide sequence or a sequence capable of hybridizing with either one of these sequences under stringent conditions. The number of bases is 5 to 50, preferably 10 to 30 and further preferably 10 to 25.
In the case of having a deletion on and downstream of exon 4, more specifically, a deletion of the C terminal region of PD-L1 protein due to a structural abnormality of PD-L1 gene, more specifically a case having a truncated ORF, the abnormal protein expressed reacts with an antibody against the C terminal region of PD-L1 protein (antibody against the C terminal of PD-L1) and does not react with an antibody against the N terminal region of PD-L1 protein (antibody against the N terminal of PD-L1). Accordingly, if the antibody against the C terminal of PD-L1 and the antibody against the N terminal of PD-L1 are used to examine the reactivity between both antibodies and the PD-L1 protein produced, the structural abnormality of PD-L1 gene can be identified. More specifically, for example, PD-L1 protein in a tumor cell is stained with an antibody against the C terminal of PD-L1 and an antibody against the N terminal of PD-L1, which are stained with e.g., a fluorescence dye, to visualize the PD-L1 protein. If the protein is stained with the anti N terminal antibody but not stained with the anti C terminal antibody, it can be determined that the PD-L1 gene has a structural abnormality.
When presence of an abnormality of PD-L1 gene relating to acceleration of PD-L1 gene expression in a tumor cell taken from a subject is found by the method of the present invention, it is possible to evaluate and determine that a PD-1/PD-L1 blockade has an effect on a malignant tumor of a subject with a high probability. Also, in a tumor cell of a malignant tumor, if the presence of abnormality of PD-L1 gene relating to acceleration of PD-L1 gene expression is found, it is possible to evaluate and determine that a PD-1/PD-L1 blockade has an effect on the malignant tumor with a high probability.
It is considered that the percentage of patients to which a PD-1/PD-L1 blockade effectively works varies depending upon the type of malignant tumor. For example, in adult T cell leukemia/lymphoma, stomach cancer, large intestinal cancer, bladder cancer, cervical cancer, renal cancer, lung cancer, skin malignant melanoma, B cell lymphoma, esophageal cancer, head and neck cancer and uterine body cancer, if a transcript has a 3′UTR abnormality, expression of PD-L1 is known to be accelerated. With respect to patients suffering from these malignant cancers, whether a PD-1/PD-L1 blockade is effective or not can be evaluated by the method of the present invention. Furthermore, with respect to patients suffering from the other malignant tumors, whether a PD-1/PD-L1 blockade is effective or not can be evaluated by the method of the present invention.
Moreover, for example, in adult T cell leukemia and, stomach cancer, the ratio of the patients on which a PD-1/PD-L1 blockade effectively works is high but it is possible that the ratio is low in e. g., malignant melanoma, lung cancer and renal cancer. The method of the present invention not only enables to evaluate and determine the effectiveness of a PD-1/PD-L1 blockade on the patients suffering from a malignant tumor (the ratio of patients effectively treated with a PD-1/PD-L1 blockade is high) but also enables to evaluate and determine the effectiveness of a PD-1/PD-L1 blockade on the patients suffering from a malignant tumor (the ratio of patients effectively treated with a PD-1/PD-L1 blockade is low and a PD-1/PD-L1 is not conventionally applied).
More specifically, the present invention relates to a method of predicting whether or not a PD-1/PD-L1 blockade is effective for treating a subject suffering from a malignant tumor, and includes a method comprising detecting genomic abnormality relating to effectiveness of a PD-1/PD-L1 blockade in a tumor cell taken from a subject suffering from a malignant tumor on which a PD-1/PD-L1 blockade have a low effect and evaluating that the PD-1/PD-L1 blockade is effective for treating the subject when an abnormality is present, thereby expanding the range of the indication for the PD-1/PD-L1 blockade to the tumor on which the PD-1/PD-L1 blockade has a low effect.
As mentioned above, the method of the present invention enables to evaluate and determine whether a PD-1/PD-L1 blockade is effective or not for various types of malignant tumors or patients suffering from various types of malignant tumors and enables to select an appropriate treatment method for a patient.
If an abnormality of PD-L1 gene relating to acceleration of the PD-L1 gene expression is found in tumor cells taken from a subject, and if a PD-1/PD-L1 blockade can be evaluated and determined to effectively treat a malignant tumor of the subject with a high probability, an immune checkpoint blockade such as a PD-1/PD-L1 blockade containing an anti PD-1 monoclonal antibody or an anti PD-L1 monoclonal antibody may be administered to the subject.
The dosage varies depending on e.g., the age, body weight and symptom. The dosage of 0.001 mg to 100 mg per dose may be administered by parenteral administration such as intravenous injection, intraperitoneal injection, subcutaneous injection and intramuscular injection or oral administration at intervals of several days, several weeks or several months. The blockade to be administered may contain a pharmacologically acceptable carrier, diluent or excipient. The dosage form of the blockade is not limited, a dosage form for oral administration such as a tablet, a capsule, a granule, a powder and a syrup, or a dosage form for parenteral administration such as an injection, a drip, a suppository and a spray may be mentioned.
EXAMPLES
The present invention will be more specifically described by way of the following Examples; however, the present invention is not limited by these Examples.
1. Search for Structural Abnormality in 9p24.1 Region in RNA Sequencing (57 Cases) and Whole Genome Sequencing (11 Cases)
(Method)
RNA sequencing of 57 tumor specimens of ATL (adult T cell leukemia) and total genome sequencing of tumor-normal (buccal mucosa) pairs of ATL (11 cases) were performed.
RNA of tumor specimens was extracted by the RNeasy Mini kit (QIAGEN) and RINe was measured by the Agilent RNA ScreenTape System (Agilent).
A library for RNA sequencing was constructed by using RNA (200 to 500 ng) having RINe of 7 or more by the NEBNext Ultra RNA Library Prep Kit (New England Biolabs) and the nucleotide sequence was determined by HiSeq2000/2500. The data were analyzed by use of the algorithm called as Genomon Fusion (http://genomon.hgc.jp/rna/) publicly disclosed by the human genome analysis center of the Institute of Medical Science, the University of Tokyo. In this manner, fusion genes were identified and expression of the genes was analyzed.
A library of the whole genome sequence was constructed by using WGS using NEBNext DNA Library Prep Reagent (New England Biolabs) and nucleotide sequences were determined by HiSeq2000/2500.
Analysis was carried out as described in TOTOKI Y. et al., NATURE GENETICS 46, 1267-1273 (2014) (doi: 10.1038/ng.3126).
(Results)
The results are shown in
A wide variety of structural abnormalities were found as follows: tandem duplication (bold diagonal line from the upper right to the lower left): three cases; inversion (thin diagonal line from the upper left to the lower right): three cases; translocation (open): three cases; and deletion (thin-line from the upper right to the lower left): two cases.
However, all these cases commonly had a deletion of 3′UTR (untranslated region responsible for post transcriptional regulation).
CD274 was intact up to exon 5 in all cases; however, a part of the region on and downstream exon 5 was truncated in some cases.
2. Analysis on the Relationship Between Structural Abnormality of RNAseq (57 Cases) and CD274 Expression
(Method)
The relationship between structural abnormality and CD274 expression was analyzed based on the results of RNA sequencing using ATL (57 cases) tumor specimens of Example 1.
As an expression value, FPKM (Fragments Per Kilobase of transcript per Million fragments sequenced) was used.
(Results)
The results are shown in
In the cases having a structural abnormality (common in Example 1), high expression of CD274 was observed.
CD274 is remarkably and highly expressed in almost all cases having a structural abnormality (+), compared to the cases (solid) having no structural abnormality.
3. Analysis on Expression in Individual Exons of CD274
(Method)
Using RNA sequencing data of ATL (57 cases) in Example 2, the sequence reads were displayed at individual exons of CD274 (NM_014143) by IGV (integrative genome viewer) (provided by Broad Institute).
CD274 consists of 7 exons and exon 7 is mostly occupied by 3′UTR.
(Results)
The results are shown in
4. Expression in Exon 3, and Relationship Between the Ratio of Expression in Exon 3 and Expression in 3′UTR and CD274 Structural Abnormality
(Method)
In the cases having a structural abnormality (+), expression in 3′UTR disappears. Thus, expression is underestimated when expression of the whole gene is evaluated as is in Example 3. As a result, the relationship with structural abnormality likely to be unclear. Then, using RNA sequencing data of ATL (57 cases) of Example 3, the ratios of expression of individual exons of CD274 and expression of 3′UTR were calculated. Of the calculation results, expression of exon 3, which had the most clear relationship with structural abnormality, and the ratio of exon 3 expression/3′UTR expression (ex3 exp/3′UTR exp) was displayed as a scatter chart.
(Results)
The results are shown in
5. Analysis of a Transcript Truncated in the Middle of CD274 Identified in ATL
(Method)
In about half of CD274 structural abnormality (+) cases (11 cases) identified based on RNA sequencing results of ATL cases (57 cases), transcripts were truncated at exon 5 or exon
6. In these cases, the sequences of the transcripts were confirmed by RNA sequencing to identify the sequences.
(Results)
The results are shown in
6. Amino Acid Sequence of the Case where CD274 Transcript is Truncated in the Middle
(Method)
NP_054862 was used as a reference sequence. Based on the sequence of the transcript of Example 5, the amino acid sequence of a case where CD274 was truncated in the middle was identified in silico.
(Results)
The results are shown in
In
In the truncated CD274 (Miya15, Miya24, Miya26, Miya30, Sas8, Kyo4), the first two domains are maintained intact, suggesting that the alternative transcripts can function as CD274 with a high probability.
7. Expression of CD274 Protein Evaluated on Membrane Surface of ATL Patient-derived Cell
(Method)
CD274 expression on the cell surface was evaluated by flow cytometry using tumor cells in the case where a CD274 structural abnormality was identified by RNA sequencing. Tumor cells were stained with PE/Cy7 anti-human CD274 (B7-H1, PD-L1) Antibody (clone: 29E.2A3, BioLegend) and analyzed by LSR2 Fortessa (BD Biosciences).
(Results)
The results are shown in
The results show that CD274 is highly expressed at a protein level in the cases having a structural abnormality (+).
8. Analysis of CD274 Structural Abnormality in Various Types of Malignant Tumors Based on TCGA Data and Expression
(Method)
Using RNA sequencing data stored in the U.S. database of next generation sequence data of various types of malignant tumors, TCGA (https://tcga-data.nci.nih.gov/tcga/), CD274 structural abnormalities in various types of malignant tumors and expression were analyzed.
(Results)
The results are shown in
(Ctrl: Control)
The numbers in the figure represent the number of specimens of individual tumors subjected to RNA sequencing. In total, 10,000 cases or more were analyzed.
9. CD274 Expression in Individual Cancers
(Method)
TCGA publicly discloses expression data (RSEM values are employed and RPKM values are employed only in stomach cancer) calculated based on RNA sequencing data. CD274 expression levels (after logarithmic transformation) of individual cancer cases obtained based on the data were displayed as a histogram.
(Results)
10. Analysis of CD274 Expression Based on TCGA Data
(Method)
With respect to the cases exhibiting a TCGA cutoff value or more (high CD274 expression case), expressions of individual exons were evaluated based on the RNA sequencing data already mapped, in the same manner as in Example 4, and displayed by the IGV (integrative genome viewer) (provided by Broad Institute).
(Results)
The results are shown in
In
Numbers 1 to 7 in the lower parts of
The results shown in
11. Detection of CD274 Abnormality Using SNP Array
(Method)
Copy number analysis was performed by SNP array (method: GISTIC) in ATL 426 cases.
From patients who were diagnosed as ATL and their informed consents were obtained, tumor specimens were taken in accordance with the protocol approved by the ethical committee of Kyoto University and subjected to global genetic mutation analysis.
First, copy number analysis using tumor specimens of ATL 426 cases was carried out by SNP array (Affymetrix 250K 282 cases, Illumina 610K 144 cases). As the algorithm, CNAG/AsCNAR and GISTIC2.0 were used. An increase or decrease in number of copies at local sites was identified.
(Results)
The results based on GISTIC are shown in
The results based on CNAG are shown in
12. Detection of CD274 Abnormality by RQ-PCR
(Method)
Expression of CD274 was evaluated by RQ-PCR in 13 ATL cases.
RNA was extracted from ATL tumor specimens by RNeasy Mini kit (QIAGEN) and subjected to reverse transcription by ReverTra Ace (registered trade mark) qPCR RT Kit (TOYOBO), and then, PCR was carried out by SYBR Premix Ex Taq II (TAKARA). The sequence of the forward primer was GGCATCCAAGATACAAACTCAA (SEQ ID NO: 10) and the sequence of the reverse primer was CAGAAGTTCCAATGCTGGATTA (SEQ ID NO: 11). In PCR, a holding step was carried out at 95° C. 10 sec, and a cycling step (95° C. 5 sec, 60° C. 30 sec, 72° C. 30 sec) was repeated 50 times. Detection was carried out by LightCycler (registered trade mark) 480 System (Roche Applied Science). As the internal control, 18S was used and the ratio to CD274 was shown.
(Results)
The results are shown in
13. Immunostaining PD-L1 in ATL
(Method)
In three cases, i.e., ATL059 having no PD-L1 structural abnormality (SV: structural variation), ATL075 of PD-L1 SV (+) having an intact ORF and ATL012 of SV (+) having a truncated ORF, PD-L1 was immuno-stained with an anti N terminal antibody (E1J2J, Cell Signaling Technology) and an anti C terminal antibody (SP142, Spring Bioscience).
An antigen antibody complex was visualized by Histofine (registered trade mark) Simple Stain MAX PO (Nichirei Bioscience).
(Results)
The results are shown in
As shown in
As shown in
The results show that if PD-L1 SV is present, expression of PD-L1 (at a protein level) is strong and increases. The fact that ATL012 is not stained with the anti C terminal antibody is consistent with the fact that ORF is truncated. Further, the results show that PD-L1 SV can be identified by double staining with the anti N terminal antibody and anti C terminal antibody.
The results show that the same results are obtained also in western blot by antibodies against PD-L1, i.e., an anti N terminal antibody and an anti C terminal antibody.
14. Expression of PD-L1 in Various Types of Carcinomas
(Method)
Cases (lowest 30 cases) corresponding to top 10% were selected based on 33 types of carcinomas (solid cancer) publicly disclosed from TCGA and expression data (RSEM values) calculated based on RNA sequencing data of 10210 cases. RNA sequencing data were downloaded, and cases of CD274 fusion gene (+) and/or a virus insert (+) in the CD274 region and/or a relative high CD274 exon 4/3′UTR ratio were selected. As to DLBC and STAD, since a frequency was high, all cases were used as subjects.
RNA sequencing data of total 1691 cases were downloaded and analyzed. Based on the data, expression of CD274 (after RPKM value of exon 4 was logarithmically transformed) of individual cases of each carcinoma was displayed.
(Results)
The results are shown in
In
In 12 cancer tissues in total (26 cases in total), CD274 fusion gene (+) and/or a virus insert (+) in the CD274 region and/or a relatively high CD274 exon 4/3′UTR ratio were observed. From the results, it was found that an abnormality of truncated 3′UTR in CD274 was observed in various types of cancers. Further, these cases mostly occur where CD274 is most highly expressed in carcinomas, suggesting that 3′UTR is extremely important for regulating CD274 expression.
BLCA: bladder carcinoma: single case
CESC: cervical squamous cell carcinoma: 2 cases
COAD: colon adenocarcinoma: 2 cases
DLBC: diffuse large B-cell lymphoma: 4 cases
ESCA: esophageal carcinoma (: single case
HNSC: head-neck squamous cell carcinoma: single case
KIRC: kidney clear cell carcinoma: single case
LUAD: lung adenocarcinoma: 2 cases
READ: rectal adenocarcinoma: single case
SKCM: skin cutaneous melanoma: single case
STAD: stomach adenocarcinoma: 9 cases
UCEC: uterine corpus endometrial carcinoma: single case
15. Insertion of Carcinogenesis Virus in the CD274 Region and Abnormality of CD274 3′UTR
(Method)
Using 1,691-case RNA sequencing data downloaded from TCGA, whether insertion of a cancer-related virus in the genome is found within CD274 gene or the periphery thereof was investigated.
(Results)
Of them, in the 26 cases as mentioned above, three cases (CESC: single case, HNSC: single case, STAD: single case) had an insertion of a carcinogenesis virus in the CD274 region.
In the VS-A9U7-01 case (CESC) having an insert of Human papilloma virus (HPV) 16 in intron 6 of CD274, the ORF of a CD274 transcript was truncated in exon 6 and a transcript having CD274 intron 6 followed by HPV (human papilloma virus) E2/E5 gene was formed.
In the FP-7998-01 case (STAD) having an insert of Epstein-Barr virus (EBV) in intron 3 of PLGRKT, which is an upstream gene adjacent to CD274, tandem duplication including the region occurred and a CD274 transcript was truncated at 3′UTR.
These results show that insertion of a carcinogenesis virus in the CD274 region is associated with abnormality of CD274 3′UTR.
16. CD274 Expression is Remarkably Increased by Introducing a Deletion or an Inversion in CD274 3′UTR by CRISPR/Cas9 System.
(Method)
A human (upper panel) or mouse (lower panel) cell line was transfected with sgRNA and Cas9 (targeting two sites: 5′ end and 3′ end of CD274 3′UTR). In this manner, to these cell lines, a deletion or inversion corresponding to the whole length (2.7 kb) of CD274 3′UTR was introduced by CRISPR (clustered regularly interspaced short palindoromic repeats)/Cas9 system. The resultant cells were purified and CD274 expression on the cell surface was evaluated by flow cytometry. Whether a desired deletion or inversion was introduced was confirmed by PCR and sequencing.
As subjects, human cell lines, i.e., HEK293T (fetal kidney), T2 (hybrid of T cell and B cell), PC-9 (lung cancer) and mouse cell lines, i.e., EG7-OVA (T cell lymphoma, expressing Ovalbumin), P815 (mastocytoma) and B16-F10 (malignant melanoma) were selected.
(Results)
The results are shown in
As a result, in all human/mouse cell lines used as subjects, the cell lines (SgPD-L1 FxR) having a deletion or an inversion introduced in the 3′UTR exhibited a remarkable increase in CD274 expression, compared to parental cell lines and mock introduced cell lines.
These results experimentally prove that there is a causal relationship between a structural abnormality of CD274 3′UTR identified by gene analysis and high expression of CD274; more specifically that overexpression of CD274 is induced by abnormality of CD274 3′UTR.
17. High Expression of CD274 in Association with CD274 3′UTR Abnormality Induces Apoptosis of PD-1 Expressing T Cells
(Method)
To evaluate the effect of high expression of CD274 in association with CD274 3′UTR abnormality on the immunity system in vitro, a PC-9 cell line in which high expression of CD274 in association with CD274 3′UTR abnormality was induced by the CRISPR-Cas9 system or a control cell line (Mock), and Jurkat T cell line having PD-1 introduced therein or a control cell line having no (Mock) PD-1 introduced therein were co-cultured and thereafter the degree of apoptosis of the Jurkat T cells was evaluated by flow cytometry using Annexin-V.
(Results)
The results are shown in
It was shown that high expression of CD274 in association with CD274 3′UTR abnormality strongly induces apoptosis of T cells expressing PD-1 (the results of isotype control on the right in
The results suggest that high expression of CD274 in association with CD274 3′UTR abnormality is responsible for escape from immunity.
18. High Expression of CD274 in Association with CD274 3′UTR Abnormality Promotes Tumorigenesis.
(Method)
To evaluate the effect of high expression of CD274 in association with CD274 3′UTR abnormality on tumorigenic potential in vivo, EG7-OVAcell line (SgPd-L1) in which high expression of CD274 in association with CD274 3′UTR abnormality was induced by the CRISPR-Cas9 system and a control cell line (Mock) were subcutaneously transplanted to the isogenic mice. An immunostimulating agent, poly (I: C) or PBS as a control was administered from 7th day after the transplantation and a tumor diameter was periodically measured. In this experiment, it is considered that poly (I: C) induces an immunity against a tumor (in particular ovalbumin).
(Results)
In the control cell line, a reduction in tumor diameter by administration of poly (I: C) was observed; however, in the cell line having high expression of CD274 in association with CD274 3′UTR abnormality, tumor increased, even if poly (I: C) was administered, to the same level as in the cell line to which poly (I: C) was not administered.
The results show that high expression of CD274 in association with CD274 3′UTR abnormality can overcome the tumor suppressing effect by antitumor immunity, in vivo.
19. High Expression of CD274 in Association with CD274 3′UTR Abnormality Suppresses Infiltration of CD8 Positive T Cells into Tumor.
(Method)
In the experiment of transplantation of EG7-OVA cell line to isogenic mice performed in the same manner as in Example 18, a tumor was taken from a mouse on 14 or 15th day after the transplantation and immuno-stained with CD8 and DAPI. In this manner, infiltration of CD8 positive T cells into the tumor was evaluated. The number of CD8 positive cells was counted in no less than 20 viewing fields of slices taken from representative 2 to 3 mice.
(Results)
In the control cell line (Mock), infiltration of CD8 positive T cells into the tumor was increased by poly (I: C) administration; however, in the cell line (SgPD-L1) highly expressing CD274 in association with CD274 3′UTR abnormality, even if poly (I: C) was administered, the number of infiltrating cells only slightly increased.
The results suggest that high expression of CD274 in association with CD274 3′UTR abnormality has a suppressive effect of infiltration of CD8 positive cytotoxicity T cells into a tumor in vivo.
20. PD-1/PD-L1 Block can Suppress Promotion of Tumor Formation and Immunosuppressive Effect by High Expression of CD274 in Association with CD274 3′UTR Abnormality.
(Method)
To confirm the effect of PD-1/PD-L1 block against tumorigenic potential due to high expression of CD274 in association with CD274 3′UTR abnormality in vivo, an EG7-OVA cell line, in which high expression of CD274 in association with CD274 3′UTR abnormality was induced by CRISPR-Cas9 system, was subcutaneously transplanted to the isogenic mice. To mice to which an immunostimulating agent, poly (I: C), was administered, an anti PD-L1 antibody or an isotype control was intraperitoneally injected and the effect on the EG7-OVA tumor was evaluated. In these recipient mice, the diameter of a tumor was periodically measured. Fourteenth or fifteenth day after the transplantation, immunostaining with CD8 and DAPI were carried out to evaluate the extent of infiltration of CD8 positive T cells into the tumor.
(Results)
As shown in the figures, it was found that tumorigenicity and infiltration of CD8 positive T cells into a tumor are suppressed by an anti PD-L1 antibody.
The results show that PD-1/PD-L1 block can suppress tumor formation and immunosuppressive effect due to high expression of CD274 in association with CD274 3′UTR abnormality in vivo.
21. Mutant in which a CD274 ORF was Truncated by CD274 SV Maintains PD-1 Binding Ability.
(Method)
Using ATL patient's specimens (5 specimens of ATL049, ATL050, ATL022 and ATL079) or a PC-9 cell line, to which CD274 wild type (WT) or a truncation mutant was introduced by a retrovirus, the binding ability to PD-1 Ig was evaluated by flow cytometry. Of the ATL patient's specimens, ATL050 had intact ORF (Intact) without truncation, ATL022 and ATL079 had a truncated ORF (Truncated). The mutant introduced into PC-9 was derived from ATL020 (defective Ex7) or ATL079 (defective Ex6 and 7).
(Results)
Either one of the ATL patient's specimens and CD274 gene-introduced PC-9 cell line, regardless of the intact or truncated ORF, binding to a receptor of PD-L1, i.e., PD-1, was confirmed.
The results show that PD-1 binding ability is not affected by truncation of CD274 ORF due to a CD274 structural abnormality and function of CD274 overexpressed as seen in CD274 SV (+) cases is maintained.
22. CD274 SV Relates to CD274 Overexpression Independently of the Number of Copies in the CD274 Region
(Method)
Using DLBC 48 specimen and STAD415 specimen downloaded from TCGA and ATL43 specimen (experimental sample of the invention), how to relate CD274 expression (exon 4 RPKM) obtained by RNA sequencing analysis and the number of copies in the CD274 region obtained by SNP array with CD274 expression, was examined. As the statistical method, covariance analysis was employed.
(Results)
In any one of DLBC, STAD and ATL, CD274 SV significantly independently related to high expression of CD274.
It is known that an increase in number of CD274 copies relates to high expression of CD274; however, the results demonstrate that CD274 SV relates to CD274 expression independently of the number of CD274 copies.
INDUSTRIAL APPLICABILITY
The present invention enables to determine the effectiveness of a PD-1/PD-L1 blockade in various types of cancers, and further determine the effectiveness of a PD-1/PD-L1 blockade per patient with a malignant tumor. As a result, the possibility of a PD-1/PD-L1 blockade in treatment of malignant tumors can be increased.
Sequence Listing Free Text
SEQ ID NO: 10, 11 primer.